Skip to content

dobry dentysta jastrzębie zdrój

3 miesiące ago

599 words

Stwierdzono, że jeden klon koduje łańcuch lekki dyneiny (Mr 8000) (LC8), który jest częścią kompleksu cytoplazmatycznej dyneiny (16). LC8 pośredniczyło w wiązaniu mRNA PTH z mikrotubulami i może odgrywać rolę w wewnątrzkomórkowej lokalizacji mRNA PTH. Wiadomo, że inne mRNA są zlokalizowane, a to zależy od regionów w ich 3 p -UTR oddziałujących z elementami cytoszkieletu (14, 15). Lokalizacja może sprzyjać bardziej efektywnemu wykorzystaniu matrycy RNA i przestrzennie ograniczonemu rozkładowi ulegającego translacji białka. Metody Konstrukty plazmidowe do transkrypcji RNA. Sondy RNA zostały transkrybowane ze szczurzego cDNA PTH w Bluescript II KS (Stratagene, La Jolla, Kalifornia, USA) w plazmidach, które zostały linearyzowane przy użyciu różnych enzymów restrykcyjnych (10) (patrz Figura 2a). Szablon dla pełnej długości RNA wytworzono przez trawienie plazmidu SmaI, sondą bez 3 -UTR przez trawienie XbaI i sondą bez 60 terminalnego nt przez trawienie DraI. Szablon 3 -UTR wytworzono przez PCR fragmentu cDNA PTH, stosując 2 oligonukleotydy komplementarne do 5. i 3. końce 3 -UTR i następnie subklonowanie do pCRII (Invitrogen Corp., San Diego, California, USA). 5. primer, który obejmował sekwencję starterów dla polimerazy T3 (podkreślony), wynosił 5. ATTAACCCTCACTAAAGGGATGCTGACGTATTC 3 .. The 3. primer miał 5. GATCATTAAACTTTA 3 .. Figura 2LC8 wiąże mRNA PTH, a nie mRNA 3 -UTR CaSR3. (a) RNA REMSA dla pełnej długości RNA PTH. Wyznakowane transkrypty dla pełnej długości RNA PTH inkubowano z rekombinowanym LC8, a następnie traktowano RNazą T1 i prowadzono na natywnej PAGE. Był jeden zespół białkowo-RNA. Zwiększenie stężenia nieznakowanego mRNA PTH bez 3 -UTR nie konkurowało o wiązanie. PTH mRNA 3a -UTR w nadmiarze konkurowało o wiązanie białka RNA nawet przy niskim stężeniu nieznakowanego RNA, co wskazuje na swoistość. Nadmiar mRNA CaSR3 (3R nie wpływał na wiązanie mRNA PTH pełnej długości do LC8. (b) REMSA dla 3 a -UTR RNA PTH i CaSR. Zrekombinowany LC8 inkubowano z różnymi sondami mRNA PTH i sondą mRNA CaSR 3a -UTR oraz z próbkami traktowanymi RNazą T1 i poddawano działaniu niedenencencyjnego żelu akrylamidowego. REMSA wykazał, że LC8 wiąże się z p-3 mRNA pR-3, a to wiązanie nie było obecne po traktowaniu proteinazą K. Sonda nie zawierająca mRNA PTH mRNA, a sonda dla mRNA pC-3R CaSR nie wykazywała wiązania. . Strzałka wskazuje na kompleks białkowy RNA. CDNA CaSR wynosi 5,1 kb (2). Transkrypcja tak dużego cDNA nie obejmowała całego cDNA, a konkretnie nie obejmowała 3a -UTR. W przypadku CaSR3 (3R, w związku z tym subklonowano 3y -UTR do Bluescript II KS (Stratagene, La Jolla, Kalifornia, USA) z użyciem fragmentu uzyskanego przez restrykcję cDNA BoPCaRI w pSPORT (GIBCO BRL, Gaithersburg, Maryland, USA). USA) z NotI i SmaI. Transkrypcję przeprowadzono z użyciem polimerazy RNA T3. Radioligowane sondy RNA do hybrydyzacji REMSA i Northwestern. Radioznakowane sondy RNA przygotowano z linearyzowanych matryc w reakcji transkrypcji, jak opisano wcześniej (10). Swoista aktywność sondy RNA wynosiła 0,5. 1,0 x 106 cpm / ng. W eksperymentach kompetycyjnych nieznakowany RNA poddano podobnej transkrypcji w obecności mM każdego z 4 nukleotydów. RNA określono ilościowo przez oglądanie na 2% żelu agarozowym. Północno-zachodni screening biblioteki ekspresyjnej HeLa (. TriplEx). Bibliotekę wysiano i płytki przeniesiono do filtrów nitrocelulozowych (Schleicher & Schuell GmbH, Dassel, Niemcy) zgodnie z instrukcjami producenta (CLONTECH Laboratories Inc., Palo Alto, California, USA). W celu identyfikacji pozytywnych klonów wyrażających białka wiążące się z mRNA PTH, membrany hybrydyzowano do sondy RNA reprezentującej pełnej długości PTH lub sondę pozbawioną 3 -UTR lub sondę reprezentującą tylko 3 p -UTR (10).
[patrz też: serwatka z mleka owczego, acetylowany adypinian diskrobiowy, rozpoznanie wg icd 10 ]

0 thoughts on “dobry dentysta jastrzębie zdrój”