Skip to content

dobry dentysta jastrzębie zdrój

10 miesięcy ago

599 words

Stwierdzono, że jeden klon koduje łańcuch lekki dyneiny (Mr 8000) (LC8), który jest częścią kompleksu cytoplazmatycznej dyneiny (16). LC8 pośredniczyło w wiązaniu mRNA PTH z mikrotubulami i może odgrywać rolę w wewnątrzkomórkowej lokalizacji mRNA PTH. Wiadomo, że inne mRNA są zlokalizowane, a to zależy od regionów w ich 3 p -UTR oddziałujących z elementami cytoszkieletu (14, 15). Lokalizacja może sprzyjać bardziej efektywnemu wykorzystaniu matrycy RNA i przestrzennie ograniczonemu rozkładowi ulegającego translacji białka. Metody Konstrukty plazmidowe do transkrypcji RNA. Sondy RNA zostały transkrybowane ze szczurzego cDNA PTH w Bluescript II KS (Stratagene, La Jolla, Kalifornia, USA) w plazmidach, które zostały linearyzowane przy użyciu różnych enzymów restrykcyjnych (10) (patrz Figura 2a). Szablon dla pełnej długości RNA wytworzono przez trawienie plazmidu SmaI, sondą bez 3 -UTR przez trawienie XbaI i sondą bez 60 terminalnego nt przez trawienie DraI. Szablon 3 -UTR wytworzono przez PCR fragmentu cDNA PTH, stosując 2 oligonukleotydy komplementarne do 5. i 3. końce 3 -UTR i następnie subklonowanie do pCRII (Invitrogen Corp., San Diego, California, USA). 5. primer, który obejmował sekwencję starterów dla polimerazy T3 (podkreślony), wynosił 5. ATTAACCCTCACTAAAGGGATGCTGACGTATTC 3 .. The 3. primer miał 5. GATCATTAAACTTTA 3 .. Figura 2LC8 wiąże mRNA PTH, a nie mRNA 3 -UTR CaSR3. (a) RNA REMSA dla pełnej długości RNA PTH. Wyznakowane transkrypty dla pełnej długości RNA PTH inkubowano z rekombinowanym LC8, a następnie traktowano RNazą T1 i prowadzono na natywnej PAGE. Był jeden zespół białkowo-RNA. Zwiększenie stężenia nieznakowanego mRNA PTH bez 3 -UTR nie konkurowało o wiązanie. PTH mRNA 3a -UTR w nadmiarze konkurowało o wiązanie białka RNA nawet przy niskim stężeniu nieznakowanego RNA, co wskazuje na swoistość. Nadmiar mRNA CaSR3 (3R nie wpływał na wiązanie mRNA PTH pełnej długości do LC8. (b) REMSA dla 3 a -UTR RNA PTH i CaSR. Zrekombinowany LC8 inkubowano z różnymi sondami mRNA PTH i sondą mRNA CaSR 3a -UTR oraz z próbkami traktowanymi RNazą T1 i poddawano działaniu niedenencencyjnego żelu akrylamidowego. REMSA wykazał, że LC8 wiąże się z p-3 mRNA pR-3, a to wiązanie nie było obecne po traktowaniu proteinazą K. Sonda nie zawierająca mRNA PTH mRNA, a sonda dla mRNA pC-3R CaSR nie wykazywała wiązania. . Strzałka wskazuje na kompleks białkowy RNA. CDNA CaSR wynosi 5,1 kb (2). Transkrypcja tak dużego cDNA nie obejmowała całego cDNA, a konkretnie nie obejmowała 3a -UTR. W przypadku CaSR3 (3R, w związku z tym subklonowano 3y -UTR do Bluescript II KS (Stratagene, La Jolla, Kalifornia, USA) z użyciem fragmentu uzyskanego przez restrykcję cDNA BoPCaRI w pSPORT (GIBCO BRL, Gaithersburg, Maryland, USA). USA) z NotI i SmaI. Transkrypcję przeprowadzono z użyciem polimerazy RNA T3. Radioligowane sondy RNA do hybrydyzacji REMSA i Northwestern. Radioznakowane sondy RNA przygotowano z linearyzowanych matryc w reakcji transkrypcji, jak opisano wcześniej (10). Swoista aktywność sondy RNA wynosiła 0,5. 1,0 x 106 cpm / ng. W eksperymentach kompetycyjnych nieznakowany RNA poddano podobnej transkrypcji w obecności mM każdego z 4 nukleotydów. RNA określono ilościowo przez oglądanie na 2% żelu agarozowym. Północno-zachodni screening biblioteki ekspresyjnej HeLa (. TriplEx). Bibliotekę wysiano i płytki przeniesiono do filtrów nitrocelulozowych (Schleicher & Schuell GmbH, Dassel, Niemcy) zgodnie z instrukcjami producenta (CLONTECH Laboratories Inc., Palo Alto, California, USA). W celu identyfikacji pozytywnych klonów wyrażających białka wiążące się z mRNA PTH, membrany hybrydyzowano do sondy RNA reprezentującej pełnej długości PTH lub sondę pozbawioną 3 -UTR lub sondę reprezentującą tylko 3 p -UTR (10).
[patrz też: serwatka z mleka owczego, acetylowany adypinian diskrobiowy, rozpoznanie wg icd 10 ]

0 thoughts on “dobry dentysta jastrzębie zdrój”