Skip to content

dr ewa czerwińska cd

3 miesiące ago

449 words

Zmodyfikowane barwienie Giemsy zastosowano do identyfikacji H. pylori. 16 Przebiegi zostały sprawdzone przez jednego patologa przed i po zakończeniu analizy molekularnej. Do drugiego przeglądu patolog nie był świadomy wyników analizy molekularnej. Rozpoznania histologiczne zostały potwierdzone przez drugiego patologa. Konsensus-sekwencja PCR
DNA ekstrahowano z zatopionych w parafinie skrawków tkanki o grubości 10 .m, jak opisano wcześniej.17 Segment 268-bp genu .-globiny amplifikowano za pomocą PCR z PCO4 (5 CAACTTCATCCACGTTCACC3 ) i GH20 (5 GAAGAGCCAAGGACAGGTAC3 ) primery (Perkin-Elmer, Norwalk, Connecticut). Zamplifikowano region 3 determinujący komplementarność (CDR3), który jest najbardziej zmiennym regionem genu łańcucha ciężkiego immunoglobuliny9, przy użyciu pół-zagnieżdżonego PCR ze starterem FR3A (5 ACACGGCC [TC] GTGTATTACTGT3 ) dla konserwatywnego region 3-szkieletowy regionu zmiennego i startery LJH (5 TGAGGAGACGGTGACC3 ) i VLJH (5 GTGACCAGGGTNCCTTGGCCCCAG3 ) dla łączącego się regionu. Reakcje PCR przeprowadzono zgodnie z metodami opisanymi przez Diss i in. 10 Próbki pobrane od pacjentów analizowano w dwóch powtórzeniach, a DNA z linii komórkowej Raji ludzkiego chłoniaka z limfocytów B zastosowano jako kontrolę pozytywną. Zastosowano także kontrolę negatywną zawierającą wszystkie odczynniki PCR bez żadnego matrycowego DNA. Produkty amplifikacji analizowano na 10 procentach nie uwycniających żeli poliakrylamidowych i wizualizowano światłem ultrafioletowym po barwieniu bromkiem etydyny. Obecność odrębnego pojedynczego pasma (z lub bez innych mniej intensywnych pasm, odzwierciedlających tworzenie heterodupleksu) uważano za wskazującą monoklonalność, obecność kilku silnie zabarwionych odrębnych pasm oligoklonalności i obecność wymazu poliklonalności produktów amplifikowanych. 18,19
Klonowanie i sekwencjonowanie produktów PCR
Monoklonalne prążki z co najmniej dwóch różnych próbek zawierających chłoniaka od każdego pacjenta wycięto z żelu poliakrylamidowego. DNA ekstrahowano19,20 i oczyszczano kolumnami Sephacryl MicroSpin S-400 HR (Pharmacia, Uppsala, Szwecja). Klonowanie i sekwencjonowanie CDR3 przeprowadzono z zestawem wektora pMOSBlue T-wektor (Amersham, Little Chalfont, Buckinghamshire, Wielka Brytania) i zestawem Sequenase DNA Sequencing (wersja 2.0, Amersham), zgodnie z instrukcjami producenta.
PCR allelospecyficzny
Oligonukleotydy swoiste dla allelu zaprojektowano dla każdego pacjenta z sekwencji CDR3 dominujących klonów (tj. Identyczne klony reprezentujące co najmniej trzy z sześciu rekombinantów badanych od każdego pacjenta) i stosowano jako startery 5 do przeprowadzenia zagnieżdżonej PCR w DNA z próbek biopsji wykazujących zapalenie żołądka u dwóch pacjentów. Sekwencjom CDR3 przypisano numery dostępu GenBank AF016207 i AF016208 w przypadku dwóch klonów w Pacjentach i AF016215 w przypadku dominującego klonu w Pacjentu 2. Pierwszą rundę amplifikacji przeprowadzono w taki sam sposób jak PCR dla sekwencji konsensusowej CDR3; w drugiej rundzie oligonukleotyd specyficzny dla allelu był stosowany jako starter w połączeniu z konsensusowym starterem VLJH. DNA z próbki z sekwencjonowanego chłoniaka od każdego pacjenta zastosowano jako kontrolę pozytywną
[przypisy: Mimośród, opadnięta powieka, suprasorb ]
[hasła pokrewne: opadnięta powieka, kątnica jelita grubego, rozpoznanie wg icd 10 ]

0 thoughts on “dr ewa czerwińska cd”